Sample ID: Bac2_dnaX
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:12 |
| Analysis completed | 2025-05-03 01:28:12 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Bacteria. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
No taxa of interest provided at rank genus/species
| Locus | dnaX |
| Preliminary ID | Bacteria |
| Taxa of interest | |
| Country | Australia |
| Host | potato (Solanum tuberosum) |
| Sample ID | Bac2_dnaX |
| Query DNA sequence |
>Bac2_dnaX GTTGTCGGTCAGGAACATGTCCTGACCGCGTTGGCTAACGGCCTTTCCCTAGGCAGAATT CATCACGCGTATTTGTTTTCCGGCACCCGCGGTGTCGGGAAGACGTCGATTGCCCGTTTG TTGGCAAAAGGGCTGAATTGCGAACAGGGCGTGACGGCAACGCCTTGTGGTCAGTGTGAC AACTGCCGTGAAATCGAGCAGGGCCGTTTTGTCGATTTGATCGAAATCGATGCCGCGTCT CGCACTAAAGTCGAGGACACGCGCGATCTGCTGGATAATGTGCAGTACGCTCCTGCGCGT GGGCGGTTCAAGGTGTACCTGATTGACGAAGTACACATGCTATCGCGCCACAGCTTTAAT GCGCTGCTGAAAACGCTGGAAGAGCCACCTCCGCACGTCAAATTCCTGCTGGCGACCACC GACCCGCAAAAACTGCCGGTGACCATTCTGTCGCGTTGCTTGCAATTTC
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 109 | 5 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Pectobacterium brasiliense | 102 | 100.0% | 0.0 |
Database coverage of Candidate Pectobacterium brasilienseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium carotovorum | 4 | 100.0% | 0.0 |
Database coverage of Candidate Pectobacterium carotovorumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. 21LCBS03 | 1 | 99.6% | 0.0 |
Database coverage of Candidate Pectobacterium sp. 21LCBS03This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium sp. | 1 | 99.4% | 0.0 |
Database coverage of Candidate Pectobacterium sp.This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Pectobacterium atrosepticum | 1 | 99.1% | 0.0 |
Database coverage of Candidate Pectobacterium atrosepticumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | CP136135 | Pectobacterium brasiliense strain ZRIMU1702DQ chromosome, complete genome | 469 | 100.0% | 930.173 | 0.00e+00 | 100.0% |
| 2 | CP063241 | Pectobacterium brasiliense strain ZLMLSHJ5 chromosome, complete genome | 469 | 100.0% | 930.173 | 0.00e+00 | 100.0% |
| 3 | CP085633 | Pectobacterium brasiliense strain TS20HJ1 chromosome, complete genome | 469 | 100.0% | 930.173 | 0.00e+00 | 100.0% |
| 4 | MT683983 | Pectobacterium brasiliense strain CFBP5396 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 916.298 | 0.00e+00 | 100.0% |
| 5 | PP734917 | Pectobacterium brasiliense strain 1050037 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 916.298 | 0.00e+00 | 100.0% |
| 6 | KX819354 | Pectobacterium carotovorum strain IFB5506 DNA polymerase III subunit tau (dnaX) gene, partial cds | 439 | 93.6% | 870.706 | 0.00e+00 | 100.0% |
| 7 | CP113504 | Pectobacterium brasiliense strain 21PCA_AGRO2 chromosome, complete genome | 469 | 100.0% | 922.244 | 0.00e+00 | 99.8% |
| 8 | CP128509 | Pectobacterium brasiliense strain PCC1 chromosome | 469 | 100.0% | 922.244 | 0.00e+00 | 99.8% |
| 9 | PP734875 | Pectobacterium brasiliense strain 109001 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 908.369 | 0.00e+00 | 99.8% |
| 10 | CP020350 | Pectobacterium brasiliense strain SX309 chromosome, complete genome | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 11 | LC738892 | Pectobacterium brasiliense KNUB-03-21 dnaX gene for DNA polymerase III subunit gamma and tau, partial cds | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 12 | CP146222 | Pectobacterium brasiliense strain BSROG1CAUL_A chromosome | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 13 | CP003776 | Pectobacterium carotovorum subsp. carotovorum PCC21, complete genome | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 14 | MW721603 | Pectobacterium brasiliense strain BL-2 DnaX (dnaX) gene, complete cds | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 15 | CP096821 | Pectobacterium sp. 21LCBS03 chromosome, complete genome | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 16 | LC782271 | Pectobacterium brasiliense KNUB-09-21 dnaX gene for DNA polymerase III subunit gamma and tau, partial cds | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 17 | CP059959 | Pectobacterium brasiliense strain IPO:4062 NAK:237 chromosome, complete genome | 469 | 100.0% | 914.315 | 0.00e+00 | 99.6% |
| 18 | OR651879 | Pectobacterium brasiliense strain ECC8 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 19 | OR651873 | Pectobacterium brasiliense strain BS1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 20 | OR651887 | Pectobacterium brasiliense strain ECC75 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 21 | OP360016 | Pectobacterium brasiliense strain Br3 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 22 | OR651880 | Pectobacterium brasiliense strain ECC9 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 23 | OR651888 | Pectobacterium brasiliense strain ECC76 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 24 | OR651892 | Pectobacterium brasiliense strain SP51 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 25 | PP734934 | Pectobacterium brasiliense strain 1050054 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 26 | MT683942 | Pectobacterium brasiliense strain CFBP2580 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 900.439 | 0.00e+00 | 99.6% |
| 27 | PP734895 | Pectobacterium brasiliense strain 110013 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 886.564 | 0.00e+00 | 99.6% |
| 28 | PP734950 | Pectobacterium brasiliense strain ECC81 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 886.564 | 0.00e+00 | 99.6% |
| 29 | OP545929 | Pectobacterium brasiliense strain Pcb2544 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 880.617 | 0.00e+00 | 99.6% |
| 30 | OP545930 | Pectobacterium brasiliense strain Pcb2562 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 880.617 | 0.00e+00 | 99.6% |
| 31 | OP121184 | Pectobacterium brasiliense strain 21PA01 chromosomal replication initiator protein (dnaX) gene, partial cds | 443 | 94.5% | 862.776 | 0.00e+00 | 99.5% |
| 32 | CP059960 | Pectobacterium brasiliense strain IPO:4060 NAK:251 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 33 | CP059963 | Pectobacterium brasiliense strain IPO:3649 NAK:375 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 34 | OM320998 | Pectobacterium brasiliense strain SJDR DnaX (dnaX) gene, partial cds | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 35 | CP065031 | Pectobacterium brasiliense strain F126 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 36 | CP059962 | Pectobacterium brasiliense strain IPO:3710 NAK:380 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 37 | CP059957 | Pectobacterium brasiliense strain IPO:4071 NAK:240 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 38 | CP092039 | Pectobacterium brasiliense strain 130 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 39 | CP059955 | Pectobacterium brasiliense strain IPO:4134 NAK:395 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 40 | LC744201 | Pectobacterium brasiliense KNUB-04-21 dnaX gene for DNA polymerase III subunit gamma and tau, partial cds | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 41 | MF954607 | Pectobacterium sp. strain NY1563A DnaX (dnaX) gene, partial cds | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 42 | CP059961 | Pectobacterium brasiliense strain IPO:4057 NAK:249 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 43 | CP059958 | Pectobacterium brasiliense strain IPO:4065 NAK:223 chromosome, complete genome | 469 | 100.0% | 906.386 | 0.00e+00 | 99.4% |
| 44 | OP018929 | Pectobacterium brasiliense strain ECC17 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 45 | MT684044 | Pectobacterium brasiliense strain CFBP8476 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 46 | OR651882 | Pectobacterium brasiliense strain ECC18 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 47 | PP734885 | Pectobacterium brasiliense strain 109012 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 48 | PP734946 | Pectobacterium brasiliense strain ECC63 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 49 | OR651871 | Pectobacterium brasiliense strain Ag1-b DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 50 | OR651870 | Pectobacterium brasiliense strain Ag1-a DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 51 | MT684036 | Pectobacterium brasiliense strain CFBP7357 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 52 | MT684016 | Pectobacterium brasiliense strain CFBP6594 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 892.51 | 0.00e+00 | 99.4% |
| 53 | OR651869 | Pectobacterium brasiliense strain 1050006 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 878.635 | 0.00e+00 | 99.3% |
| 54 | OP018932 | Pectobacterium brasiliense strain TSR25 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 878.635 | 0.00e+00 | 99.3% |
| 55 | OP545933 | Pectobacterium brasiliense strain Pcb2842 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 872.688 | 0.00e+00 | 99.3% |
| 56 | OP545927 | Pectobacterium brasiliense strain Pcb33 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 872.688 | 0.00e+00 | 99.3% |
| 57 | OP545928 | Pectobacterium brasiliense strain Pcb62 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 872.688 | 0.00e+00 | 99.3% |
| 58 | OP545934 | Pectobacterium brasiliense strain Pcb2861 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 872.688 | 0.00e+00 | 99.3% |
| 59 | MW979072 | Pectobacterium brasiliense strain NY1563A DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 850.883 | 0.00e+00 | 99.3% |
| 60 | MW978986 | Pectobacterium brasiliense strain CIR1070 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 850.883 | 0.00e+00 | 99.3% |
| 61 | MW978975 | Pectobacterium brasiliense strain CIR1052 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 850.883 | 0.00e+00 | 99.3% |
| 62 | KX819356 | Pectobacterium carotovorum strain IFB5508 DNA polymerase III subunit tau (dnaX) gene, partial cds | 439 | 93.6% | 846.918 | 0.00e+00 | 99.3% |
| 63 | OR521244 | Pectobacterium brasiliense strain BP7089 DnaX gene, partial cds | 434 | 92.5% | 837.007 | 0.00e+00 | 99.3% |
| 64 | OR521245 | Pectobacterium brasiliense strain BP7090 DnaX gene, partial cds | 434 | 92.5% | 837.007 | 0.00e+00 | 99.3% |
| 65 | OR521240 | Pectobacterium brasiliense strain BP7072 DnaX gene, partial cds | 434 | 92.5% | 837.007 | 0.00e+00 | 99.3% |
| 66 | OR521243 | Pectobacterium brasiliense strain BP7088 DnaX gene, partial cds | 434 | 92.5% | 837.007 | 0.00e+00 | 99.3% |
| 67 | OR521242 | Pectobacterium brasiliense strain BP7087 DnaX gene, partial cds | 434 | 92.5% | 837.007 | 0.00e+00 | 99.3% |
| 68 | OR521241 | Pectobacterium brasiliense strain BP7081 DnaX gene, partial cds | 434 | 92.5% | 837.007 | 0.00e+00 | 99.3% |
| 69 | CP024780 | Pectobacterium brasiliense strain BZA12 chromosome, complete genome | 469 | 100.0% | 898.457 | 0.00e+00 | 99.1% |
| 70 | GQ904832 | Pectobacterium atrosepticum strain IPO 998 DNA polymerase III subunits gamma and tau (dnaX) gene, partial cds | 469 | 100.0% | 898.457 | 0.00e+00 | 99.1% |
| 71 | PP869810 | Pectobacterium brasiliense strain IFB5714 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 898.457 | 0.00e+00 | 99.1% |
| 72 | OR651872 | Pectobacterium brasiliense strain BC1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 884.581 | 0.00e+00 | 99.1% |
| 73 | MT683919 | Pectobacterium brasiliense strain CFBP1350 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 884.581 | 0.00e+00 | 99.1% |
| 74 | MK516927 | Pectobacterium brasiliense strain CFBP5392 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 884.581 | 0.00e+00 | 99.1% |
| 75 | OP360019 | Pectobacterium brasiliense strain Br6 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 870.706 | 0.00e+00 | 99.1% |
| 76 | OP545925 | Pectobacterium brasiliense strain Pcb133 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 864.759 | 0.00e+00 | 99.1% |
| 77 | OP545926 | Pectobacterium brasiliense strain Pcb134 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 864.759 | 0.00e+00 | 99.1% |
| 78 | MW978956 | Pectobacterium brasiliense strain BP7029 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 842.954 | 0.00e+00 | 99.1% |
| 79 | MT683978 | Pectobacterium brasiliense strain CFBP5390 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 438 | 93.4% | 837.007 | 0.00e+00 | 99.1% |
| 80 | LC798274 | Pectobacterium brasiliense P9 dnaX gene for DNA polymerase III subunit tau, partial cds | 437 | 93.2% | 835.025 | 0.00e+00 | 99.1% |
| 81 | OR521248 | Pectobacterium brasiliense strain BP7070 DnaX gene, partial cds | 434 | 92.5% | 829.078 | 0.00e+00 | 99.1% |
| 82 | PP734884 | Pectobacterium brasiliense strain 109011 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 876.652 | 0.00e+00 | 98.9% |
| 83 | MT683952 | Pectobacterium brasiliense strain CFBP3230 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 876.652 | 0.00e+00 | 98.9% |
| 84 | MT683926 | Pectobacterium brasiliense strain CFBP1458 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 876.652 | 0.00e+00 | 98.9% |
| 85 | OR651878 | Pectobacterium brasiliense strain ECC7 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 862.776 | 0.00e+00 | 98.9% |
| 86 | OR651874 | Pectobacterium brasiliense strain CB1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 862.776 | 0.00e+00 | 98.9% |
| 87 | OR651875 | Pectobacterium brasiliense strain CB2 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 862.776 | 0.00e+00 | 98.9% |
| 88 | OR651893 | Pectobacterium brasiliense strain XBR1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 862.776 | 0.00e+00 | 98.9% |
| 89 | PP734933 | Pectobacterium brasiliense strain 1050053 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 862.776 | 0.00e+00 | 98.9% |
| 90 | OP328786 | Pectobacterium carotovorum culture KACC:10225 polymerase III subunit tau (dnaX) gene, partial cds | 446 | 95.1% | 844.936 | 0.00e+00 | 98.9% |
| 91 | PP869818 | Pectobacterium brasiliense strain IFB5705 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 92 | PP869811 | Pectobacterium brasiliense strain IFB5710 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 93 | PP869813 | Pectobacterium brasiliense strain IFB5708 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 94 | PP869815 | Pectobacterium brasiliense strain IFB5712 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 95 | PP869814 | Pectobacterium brasiliense strain IFB5713 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 96 | CP136134 | Pectobacterium brasiliense strain ZRIMU1701SM chromosome, complete genome | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 97 | PP869817 | Pectobacterium brasiliense strain IFB5706 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 98 | PP869816 | Pectobacterium brasiliense strain IFB5707 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 99 | PP869812 | Pectobacterium brasiliense strain IFB5709 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 882.599 | 0.00e+00 | 98.7% |
| 100 | OR651891 | Pectobacterium brasiliense strain Luf DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 868.723 | 0.00e+00 | 98.7% |
| 101 | OR651890 | Pectobacterium brasiliense strain Gb2 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 868.723 | 0.00e+00 | 98.7% |
| 102 | MK516959 | Pectobacterium brasiliense strain CFBP7079 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 868.723 | 0.00e+00 | 98.7% |
| 103 | OR651889 | Pectobacterium brasiliense strain Ga2 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 868.723 | 0.00e+00 | 98.7% |
| 104 | OR651883 | Pectobacterium brasiliense strain ECC22 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 854.847 | 0.00e+00 | 98.7% |
| 105 | OP545931 | Pectobacterium brasiliense strain Pcb2811 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 848.901 | 0.00e+00 | 98.7% |
| 106 | OP545932 | Pectobacterium brasiliense strain Pcb2817 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 848.901 | 0.00e+00 | 98.7% |
| 107 | OR651894 | Pectobacterium brasiliense strain ZL6 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 860.794 | 0.00e+00 | 98.5% |
| 108 | OP018927 | Pectobacterium brasiliense strain ECC3 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 846.918 | 0.00e+00 | 98.5% |
| 109 | OR651876 | Pectobacterium brasiliense strain ECC4 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 846.918 | 0.00e+00 | 98.5% |
| 110 | OP976225 | Pectobacterium brasiliense strain PeF4 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 389 | 82.9% | 724.018 | 0.00e+00 | 98.5% |
| 111 | OP976223 | Pectobacterium brasiliense strain PeF10 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 389 | 82.9% | 724.018 | 0.00e+00 | 98.5% |
| 112 | OP976224 | Pectobacterium brasiliense strain PeF27 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 389 | 82.9% | 724.018 | 0.00e+00 | 98.5% |
| 113 | OP976220 | Pectobacterium brasiliense strain CF65 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 389 | 82.9% | 724.018 | 0.00e+00 | 98.5% |
| 114 | OP976219 | Pectobacterium brasiliense strain CF46 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 389 | 82.9% | 724.018 | 0.00e+00 | 98.5% |
| 115 | MW978989 | Pectobacterium brasiliense strain CIR1078 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 819.167 | 0.00e+00 | 98.4% |
| 116 | MT632662 | Pectobacterium brasiliense strain JB127 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 866.741 | 0.00e+00 | 98.3% |
| 117 | CP046380 | Pectobacterium brasiliense strain HNP201719 chromosome, complete genome | 469 | 100.0% | 866.741 | 0.00e+00 | 98.3% |
| 118 | CP009769 | Pectobacterium carotovorum subsp. brasiliense strain BC1, complete genome | 469 | 100.0% | 866.741 | 0.00e+00 | 98.3% |
| 119 | MT632661 | Pectobacterium brasiliense strain JB124 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 866.741 | 0.00e+00 | 98.3% |
| 120 | PP734921 | Pectobacterium brasiliense strain 1050041 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 852.865 | 0.00e+00 | 98.3% |
| 121 | MT684053 | Pectobacterium sp. strain CFBP8736 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 852.865 | 0.00e+00 | 98.3% |
| 122 | MT683971 | Pectobacterium brasiliense strain CFBP5383 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 852.865 | 0.00e+00 | 98.3% |
| 123 | MW978955 | Pectobacterium brasiliense strain BP7026 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 811.238 | 0.00e+00 | 98.2% |
| 124 | OR521247 | Pectobacterium brasiliense strain BP7062 DnaX gene, partial cds | 434 | 92.5% | 797.362 | 0.00e+00 | 98.2% |
| 125 | OR521246 | Pectobacterium brasiliense strain BP7027 DnaX gene, partial cds | 434 | 92.5% | 797.362 | 0.00e+00 | 98.2% |
| 126 | LC717494 | Pectobacterium brasiliense KNUB-01-21 dnaX gene for DNA polymerase III subunits gamma and tau, partial cds | 469 | 100.0% | 858.812 | 0.00e+00 | 98.1% |
| 127 | OR651877 | Pectobacterium brasiliense strain ECC6 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 844.936 | 0.00e+00 | 98.1% |
| 128 | OR651884 | Pectobacterium brasiliense strain ECC25 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 844.936 | 0.00e+00 | 98.1% |
| 129 | CP170503 | Pectobacterium brasiliense strain BSRLOP2CAB chromosome, complete genome | 469 | 100.0% | 850.883 | 0.00e+00 | 97.9% |
| 130 | CP059956 | Pectobacterium brasiliense strain IPO:4132 NAK:239 chromosome, complete genome | 469 | 100.0% | 850.883 | 0.00e+00 | 97.9% |
| 131 | OR651886 | Pectobacterium brasiliense strain ECC72 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 815.202 | 0.00e+00 | 97.6% |
| 132 | OR651885 | Pectobacterium brasiliense strain ECC71 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 815.202 | 0.00e+00 | 97.6% |
| 133 | MT683999 | Pectobacterium brasiliense strain CFBP5837 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 807.273 | 0.00e+00 | 97.4% |
| 134 | OR651881 | Pectobacterium brasiliense strain ECC14 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 807.273 | 0.00e+00 | 97.4% |
| 135 | PP734906 | Pectobacterium brasiliense strain 1050026 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 807.273 | 0.00e+00 | 97.4% |
| 136 | MT684023 | Pectobacterium brasiliense strain CFBP6614 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 799.344 | 0.00e+00 | 97.1% |
| 137 | MK516954 | Pectobacterium brasiliense strain CFBP6607 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 799.344 | 0.00e+00 | 97.1% |
| 138 | MK516879 | Pectobacterium aquaticum strain CFBP8637T DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 799.344 | 0.00e+00 | 97.1% |
| 139 | MW979043 | Pectobacterium brasiliense strain LMG 21370 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 771.592 | 0.00e+00 | 97.1% |
| 140 | MW979045 | Pectobacterium brasiliense strain LMG 21372 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 771.592 | 0.00e+00 | 97.1% |
| 141 | MT684017 | Pectobacterium brasiliense strain CFBP6608 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 805.291 | 0.00e+00 | 97.0% |
| 142 | MK516955 | Pectobacterium brasiliense strain CFBP6615 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 791.415 | 0.00e+00 | 96.9% |
| 143 | MW979044 | Pectobacterium brasiliense strain LMG 21371 DNA polymerase III subunit tau (dnaX) gene, partial cds | 441 | 94.0% | 763.663 | 0.00e+00 | 96.8% |
| 144 | MT683944 | Pectobacterium brasiliense strain CFBP2634 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 783.486 | 0.00e+00 | 96.7% |
| 145 | CP161828 | Pectobacterium aquaticum strain A101-S19-F16 chromosome, complete genome | 469 | 100.0% | 803.309 | 0.00e+00 | 96.6% |
| 146 | CP047495 | Pectobacterium brasiliense strain 1692 chromosome, complete genome | 469 | 100.0% | 803.309 | 0.00e+00 | 96.6% |
| 147 | CP086253 | Pectobacterium aquaticum strain A212-S19-A16 chromosome, complete genome | 469 | 100.0% | 803.309 | 0.00e+00 | 96.6% |
| 148 | LC798279 | Pectobacterium brasiliense P14 dnaX gene for DNA polymerase III subunit tau, partial cds | 437 | 93.2% | 747.805 | 0.00e+00 | 96.6% |
| 149 | MW978985 | Pectobacterium carotovorum strain CIR1068 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 747.805 | 0.00e+00 | 96.6% |
| 150 | MK516956 | Pectobacterium brasiliense strain CFBP6617T DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 789.433 | 0.00e+00 | 96.5% |
| 151 | MW657238 | Pectobacterium aquaticum strain IFB5637 DnaX (dnaX) gene, partial cds | 455 | 97.0% | 775.557 | 0.00e+00 | 96.5% |
| 152 | MK516909 | Pectobacterium carotovorum subsp. carotovorum strain CFBP2046T DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 769.61 | 0.00e+00 | 96.5% |
| 153 | OR521224 | Pectobacterium carotovorum strain BP9294 DnaX gene, partial cds | 430 | 91.7% | 733.929 | 0.00e+00 | 96.5% |
| 154 | KX819397 | Pectobacterium carotovorum subsp. carotovorum strain Sol 3-3-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 426 | 90.8% | 726.0 | 0.00e+00 | 96.5% |
| 155 | CP084655 | Pectobacterium brasiliense strain SR10 chromosome, complete genome | 469 | 100.0% | 795.38 | 0.00e+00 | 96.4% |
| 156 | CP092070 | Pectobacterium sp. PL64 chromosome, complete genome | 469 | 100.0% | 795.38 | 0.00e+00 | 96.4% |
| 157 | MW978958 | Pectobacterium carotovorum strain BP7050 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 739.876 | 0.00e+00 | 96.3% |
| 158 | MW978969 | Pectobacterium carotovorum strain CIR1030 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 739.876 | 0.00e+00 | 96.3% |
| 159 | MK516897 | Pectobacterium carotovorum subsp. carotovorum strain CFBP1402 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 761.681 | 0.00e+00 | 96.2% |
| 160 | MT684009 | Pectobacterium carotovorum strain CFBP6070 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 761.681 | 0.00e+00 | 96.2% |
| 161 | OR521228 | Pectobacterium versatile strain BP9004 DnaX gene, partial cds | 421 | 89.8% | 708.16 | 0.00e+00 | 96.2% |
| 162 | OR521230 | Pectobacterium versatile strain BP9149 DnaX gene, partial cds | 421 | 89.8% | 708.16 | 0.00e+00 | 96.2% |
| 163 | OR521229 | Pectobacterium versatile strain BP9109 DnaX gene, partial cds | 421 | 89.8% | 708.16 | 0.00e+00 | 96.2% |
| 164 | OR521231 | Pectobacterium versatile strain BP9166 DnaX gene, partial cds | 421 | 89.8% | 708.16 | 0.00e+00 | 96.2% |
| 165 | PP405239 | Pectobacterium versatile strain 21A25 DNA polymerase III subunit (dnaX) gene, partial cds | 396 | 84.4% | 666.532 | 0.00e+00 | 96.2% |
| 166 | MW978961 | Pectobacterium carotovorum strain CIR1011 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 731.947 | 0.00e+00 | 96.1% |
| 167 | MW978995 | Pectobacterium carotovorum strain CIR1100 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 731.947 | 0.00e+00 | 96.1% |
| 168 | MW979030 | Pectobacterium carotovorum strain CIR1182 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 731.947 | 0.00e+00 | 96.1% |
| 169 | MW978990 | Pectobacterium carotovorum strain CIR1080 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 731.947 | 0.00e+00 | 96.1% |
| 170 | MW978998 | Pectobacterium carotovorum strain CIR1104 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 731.947 | 0.00e+00 | 96.1% |
| 171 | MW978944 | Pectobacterium carotovorum strain 16H2-LB DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 731.947 | 0.00e+00 | 96.1% |
| 172 | KX819379 | Pectobacterium carotovorum subsp. carotovorum strain PK1045-1-2-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 727.983 | 0.00e+00 | 96.1% |
| 173 | KX819383 | Pectobacterium carotovorum subsp. carotovorum strain PK57-1-1-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 727.983 | 0.00e+00 | 96.1% |
| 174 | MT683967 | Pectobacterium carotovorum strain CFBP5376 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 431 | 91.9% | 720.054 | 0.00e+00 | 96.1% |
| 175 | PP734951 | Pectobacterium carotovorum strain ECC82 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 176 | MT684012 | Pectobacterium carotovorum strain CFBP6078 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 177 | OR651910 | Pectobacterium versatile strain XB01-3 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 178 | MT684032 | Pectobacterium carotovorum strain CFBP7350 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 179 | MK516883 | Pectobacterium sp. GT-2019 strain CFBP8654 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 180 | OP360013 | Pectobacterium carotovorum strain Br1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 181 | MK516961 | Pectobacterium carotovorum subsp. carotovorum strain CFBP7081 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 182 | MK516866 | Pectobacterium sp. GT-2019 strain A222-S6-A16 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 183 | PP734935 | Pectobacterium carotovorum strain 1050055 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 184 | MK516896 | Pectobacterium carotovorum subsp. carotovorum strain CFBP1364 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 185 | MK516890 | Pectobacterium sp. GT-2019 strain CFBP1333 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 186 | OR651909 | Pectobacterium versatile strain ECC26 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 187 | MT683975 | Pectobacterium carotovorum strain CFBP5387 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 753.752 | 0.00e+00 | 96.0% |
| 188 | OR521221 | Pectobacterium carotovorum strain BP7046 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 189 | OR521212 | Pectobacterium carotovorum strain BP7085 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 190 | OR521211 | Pectobacterium carotovorum strain BP7084 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 191 | OR521207 | Pectobacterium carotovorum strain BP7079 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 192 | OR521206 | Pectobacterium carotovorum strain BP7078 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 193 | OR521209 | Pectobacterium versatile strain BP7082 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 194 | OR521222 | Pectobacterium carotovorum strain BP7047 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 195 | OR521210 | Pectobacterium carotovorum strain BP7083 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 196 | OR521208 | Pectobacterium carotovorum strain BP7080 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 197 | OR521223 | Pectobacterium carotovorum strain BP7048 DnaX gene, partial cds | 430 | 91.7% | 718.071 | 0.00e+00 | 96.0% |
| 198 | MT683966 | Pectobacterium carotovorum strain CFBP5374 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 423 | 90.2% | 704.195 | 0.00e+00 | 96.0% |
| 199 | MT632666 | Pectobacterium carotovorum subsp. carotovorum strain JB145 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 779.521 | 0.00e+00 | 95.9% |
| 200 | MT632659 | Pectobacterium atrosepticum strain JB113 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 779.521 | 0.00e+00 | 95.9% |
| 201 | CP065177 | Pectobacterium quasiaquaticum strain A477-S1-J17 chromosome, complete genome | 469 | 100.0% | 779.521 | 0.00e+00 | 95.9% |
| 202 | MT632665 | Pectobacterium carotovorum subsp. carotovorum strain JB144 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 779.521 | 0.00e+00 | 95.9% |
| 203 | CP065178 | Pectobacterium quasiaquaticum strain A398-S21-F17 chromosome, complete genome | 469 | 100.0% | 779.521 | 0.00e+00 | 95.9% |
| 204 | MT632654 | Pectobacterium carotovorum subsp. carotovorum strain JB99 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 779.521 | 0.00e+00 | 95.9% |
| 205 | MW978947 | Pectobacterium versatile strain 16ME-31 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 724.018 | 0.00e+00 | 95.9% |
| 206 | MW979011 | Pectobacterium carotovorum strain CIR1145 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 724.018 | 0.00e+00 | 95.9% |
| 207 | MW978941 | Pectobacterium versatile strain 16H2-67 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 724.018 | 0.00e+00 | 95.9% |
| 208 | KX819320 | Pectobacterium carotovorum subsp. carotovorum strain Ewelina52 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 720.054 | 0.00e+00 | 95.9% |
| 209 | OR651844 | Pectobacterium actinidiae strain ECC13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 210 | OQ586088 | Pectobacterium versatile strain YH01 DnaX (dnaX) mRNA, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 211 | PP734931 | Pectobacterium carotovorum strain 1050051 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 212 | MK517003 | Pectobacterium sp. GT-2019 strain RNS-EII-406 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 213 | OR651845 | Pectobacterium actinidiae strain ECC23 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 214 | MT683937 | Pectobacterium carotovorum strain CFBP2145 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 215 | OQ586091 | Pectobacterium versatile strain YH04 DnaX (dnaX) mRNA, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 216 | OR651846 | Pectobacterium actinidiae strain ECC24 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 217 | OR651849 | Pectobacterium actinidiae strain Ech45 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 218 | MK516862 | Pectobacterium sp. GT-2019 strain A155-S5-M16 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 219 | MK516939 | Pectobacterium sp. GT-2019 strain CFBP6052 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 220 | OR651848 | Pectobacterium actinidiae strain ECC44 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 221 | OP545923 | Pectobacterium carotovorum strain Pcc324 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 222 | OR651843 | Pectobacterium actinidiae strain ECC10 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 223 | MK516865 | Pectobacterium sp. GT-2019 strain A197-S18-M16 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 224 | MK516953 | Pectobacterium carotovorum subsp. carotovorum strain CFBP6081 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 225 | OQ586090 | Pectobacterium versatile strain YH03 DnaX (dnaX) mRNA, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 226 | OQ586089 | Pectobacterium versatile strain YH02 DnaX (dnaX) mRNA, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 227 | OR651850 | Pectobacterium actinidiae strain Ech46 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 228 | OP545924 | Pectobacterium carotovorum strain Pcc425 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 229 | MK516983 | Pectobacterium sp. GT-2019 strain RNS-09-62-2A DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 230 | MK516967 | Pectobacterium sp. GT-2019 strain CFBP7369 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 231 | PP734898 | Pectobacterium carotovorum strain 1050018 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 232 | MT684030 | Pectobacterium carotovorum strain CFBP7082 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 233 | MK516979 | Pectobacterium sp. GT-2019 strain RNS-08-33-1A DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 234 | MK516990 | Pectobacterium sp. GT-2019 strain RNS-12-37-1-3A DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 745.823 | 0.00e+00 | 95.8% |
| 235 | MK516989 | Pectobacterium sp. GT-2019 strain RNS-11-12-1B DNA polymerase III subunit tau (dnaX) gene, partial cds | 449 | 95.7% | 739.876 | 0.00e+00 | 95.8% |
| 236 | MW979057 | Pectobacterium wasabiae strain LMG 8404 DNA polymerase III subunit tau (dnaX) gene, partial cds | 431 | 91.9% | 712.124 | 0.00e+00 | 95.8% |
| 237 | OR521213 | Pectobacterium carotovorum strain BP9067 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 238 | PQ788261 | Pectobacterium versatile strain LFLOG-90 DNA polymerase III subunit tau (dnaX) gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 239 | OR521215 | Pectobacterium carotovorum strain BP9195 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 240 | OR521219 | Pectobacterium carotovorum strain BP9128 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 241 | OR521232 | Pectobacterium versatile strain BP9002 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 242 | OR521233 | Pectobacterium versatile strain BP9052 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 243 | OR521218 | Pectobacterium carotovorum strain BP9310 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 244 | OR521220 | Pectobacterium carotovorum strain BP9174 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 245 | OR521217 | Pectobacterium carotovorum strain BP9308 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 246 | OR521214 | Pectobacterium carotovorum strain BP9164 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 247 | PQ788260 | Pectobacterium versatile strain LFLOG-78 DNA polymerase III subunit tau (dnaX) gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 248 | OR521216 | Pectobacterium carotovorum strain BP9250 DnaX gene, partial cds | 430 | 91.7% | 710.142 | 0.00e+00 | 95.8% |
| 249 | MK516919 | Pectobacterium sp. GT-2019 strain CFBP2577 DNA polymerase III subunit tau (dnaX) gene, partial cds | 427 | 91.0% | 704.195 | 0.00e+00 | 95.8% |
| 250 | MK516931 | Pectobacterium sp. GT-2019 strain CFBP5547 DNA polymerase III subunit tau (dnaX) gene, partial cds | 408 | 87.0% | 674.461 | 0.00e+00 | 95.8% |
| 251 | CP051652 | Pectobacterium carotovorum strain WPP14 chromosome, complete genome | 469 | 100.0% | 771.592 | 0.00e+00 | 95.7% |
| 252 | CP034236 | Pectobacterium carotovorum subsp. carotovorum strain BP201601.1 chromosome, complete genome | 469 | 100.0% | 771.592 | 0.00e+00 | 95.7% |
| 253 | OP729214 | Pectobacterium carotovorum strain Pc5421 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 771.592 | 0.00e+00 | 95.7% |
| 254 | MK516984 | Pectobacterium sp. GT-2019 strain RNS-09-72A DNA polymerase III subunit tau (dnaX) gene, partial cds | 447 | 95.3% | 735.912 | 0.00e+00 | 95.7% |
| 255 | OP729216 | Pectobacterium versatile strain Pv6321 DNA polymerase III subunit tau (dnaX) gene, partial cds | 444 | 94.7% | 729.965 | 0.00e+00 | 95.7% |
| 256 | LC798268 | Pectobacterium carotovorum P3 dnaX gene for DNA polymerase III subunit tau, partial cds | 438 | 93.4% | 718.071 | 0.00e+00 | 95.7% |
| 257 | LC798266 | Pectobacterium carotovorum P1 dnaX gene for DNA polymerase III subunit tau, partial cds | 437 | 93.2% | 716.089 | 0.00e+00 | 95.7% |
| 258 | MW978939 | Pectobacterium versatile strain 16H2-64-A DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 716.089 | 0.00e+00 | 95.7% |
| 259 | MW978963 | Pectobacterium versatile strain CIR1016 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 716.089 | 0.00e+00 | 95.7% |
| 260 | JN663799 | Erwinia sp. TEIC624 DNA polymerase III gamma subunit (dnaX) gene, partial cds | 422 | 90.0% | 694.284 | 0.00e+00 | 95.7% |
| 261 | MK516987 | Pectobacterium sp. GT-2019 strain RNS-10-133-4A DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 739.876 | 0.00e+00 | 95.6% |
| 262 | MK516958 | Pectobacterium sp. GT-2019 strain CFBP6699 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 263 | MK516881 | Pectobacterium sp. GT-2019 strain CFBP8652 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 264 | MT683968 | Pectobacterium sp. strain CFBP5380 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 265 | MK516994 | Pectobacterium sp. GT-2019 strain RNS-13-76-1-2A DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 266 | PP734891 | Pectobacterium versatile strain 110009 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 267 | MK516860 | Pectobacterium sp. GT-2019 strain A102-S1-F16 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 268 | PP869829 | Pectobacterium versatile strain IFB5695 DNA polymerase III subunit gamma/tau gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 269 | MK516871 | Pectobacterium sp. GT-2019 strain A73.2-S18-O15 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 270 | MK516906 | Pectobacterium sp. GT-2019 strain CFBP1552 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 271 | MK516911 | Pectobacterium sp. GT-2019 strain CFBP2137 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 272 | MK516974 | Pectobacterium sp. GT-2019 strain CFBP8657 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 273 | MK516986 | Pectobacterium sp. GT-2019 strain RNS-09-77B DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 274 | MK516870 | Pectobacterium sp. GT-2019 strain A73.1-S18-O15 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 275 | MK516992 | Pectobacterium sp. GT-2019 strain RNS-12-78-2B DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 737.894 | 0.00e+00 | 95.6% |
| 276 | KX819352 | Pectobacterium carotovorum subsp. carotovorum strain IFB5504 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 712.124 | 0.00e+00 | 95.6% |
| 277 | KX819374 | Pectobacterium carotovorum subsp. carotovorum strain Ost3-3-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 712.124 | 0.00e+00 | 95.6% |
| 278 | KX819385 | Pectobacterium carotovorum subsp. carotovorum strain PK60-1-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 712.124 | 0.00e+00 | 95.6% |
| 279 | KX819353 | Pectobacterium carotovorum subsp. carotovorum strain IFB5505 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 712.124 | 0.00e+00 | 95.6% |
| 280 | KX819351 | Pectobacterium carotovorum subsp. carotovorum strain IFB5503 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 712.124 | 0.00e+00 | 95.6% |
| 281 | OR521226 | Pectobacterium actinidiae strain BP7042 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 282 | OR521234 | Pectobacterium versatile strain BP9019 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 283 | OR521237 | Dickeya dianthicola strain BP7007 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 284 | OR521235 | Pectobacterium versatile strain BP9130 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 285 | OR521236 | Pectobacterium versatile strain BP9389 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 286 | OR521225 | Pantoea cypripedii strain BP7000 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 287 | OR521227 | Pectobacterium actinidiae strain BP7043 DnaX gene, partial cds | 430 | 91.7% | 702.213 | 0.00e+00 | 95.6% |
| 288 | CP174195 | Pectobacterium carotovorum strain PCC27 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 289 | CP173623 | Pectobacterium versatile strain M10 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 290 | MT632642 | Pectobacterium carotovorum subsp. carotovorum strain JB39 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 291 | OP729213 | Pectobacterium carotovorum strain Pc4821 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 292 | CP173610 | Pectobacterium versatile strain M22b chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 293 | MT632663 | Pectobacterium carotovorum subsp. carotovorum strain JB133 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 294 | CP173625 | Pectobacterium carotovorum strain M8a chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 295 | CP173624 | Pectobacterium carotovorum strain M8b chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 296 | MT632664 | Pectobacterium carotovorum subsp. carotovorum strain JB143 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 297 | CP173627 | Pectobacterium carotovorum strain M4a chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 298 | CP084741 | Pectobacterium carotovorum strain A077-S18-O15 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 299 | OL963572 | Pectobacterium versatile strain LXRF-1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 300 | CP173628 | Pectobacterium carotovorum strain M3 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 301 | CP063242 | Pectobacterium carotovorum strain XP-13 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 302 | CP065030 | Pectobacterium versatile strain F131 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 303 | OP729212 | Pectobacterium carotovorum strain Pc3821 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 304 | LC742808 | Pectobacterium sp. 13-115 dnaX gene for DNA polymerase III subunits gamma and tau, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 305 | MW930748 | Pectobacterium versatile strain JB133A DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 306 | CP088019 | Pectobacterium carotovorum strain 25.1 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 307 | MT632644 | Pectobacterium carotovorum subsp. carotovorum strain JB53 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 308 | MT632656 | Pectobacterium carotovorum subsp. carotovorum strain JB105 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 309 | MT632660 | Pectobacterium carotovorum subsp. carotovorum strain JB121 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 310 | CP034237 | Pectobacterium carotovorum subsp. carotovorum strain JR1.1 chromosome, complete genome | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 311 | MT632651 | Pectobacterium carotovorum subsp. carotovorum strain JB94 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 312 | OP729215 | Pectobacterium carotovorum strain Pc8321 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 763.663 | 0.00e+00 | 95.5% |
| 313 | MW805307 | Pectobacterium carotovorum subsp. carotovorum strain Pcc2520 DNA polymerase III subunit tau (dnaX) gene, partial cds | 468 | 99.8% | 761.681 | 0.00e+00 | 95.5% |
| 314 | MK516872 | Pectobacterium sp. GT-2019 strain A78-S20-O15 DNA polymerase III subunit tau (dnaX) gene, partial cds | 449 | 95.7% | 731.947 | 0.00e+00 | 95.5% |
| 315 | JN663800 | Pectobacterium atrosepticum strain TEIC3211 DNA polymerase III gamma subunit (dnaX) gene, partial cds | 446 | 95.1% | 726.0 | 0.00e+00 | 95.5% |
| 316 | MK516928 | Pectobacterium sp. GT-2019 strain CFBP5398 DNA polymerase III subunit tau (dnaX) gene, partial cds | 443 | 94.5% | 720.054 | 0.00e+00 | 95.5% |
| 317 | OQ700982 | Pectobacterium actinidiae strain Pact2 DnaX (dnaX) gene, partial cds | 422 | 90.0% | 686.355 | 0.00e+00 | 95.5% |
| 318 | OQ700981 | Pectobacterium actinidiae strain Pact1 DnaX (dnaX) gene, partial cds | 422 | 90.0% | 686.355 | 0.00e+00 | 95.5% |
| 319 | OP976226 | Pectobacterium carotovorum strain PeKo38 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 644.728 | 3.13e-180 | 95.5% |
| 320 | OP976227 | Pectobacterium carotovorum strain PeKo71 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 644.728 | 3.13e-180 | 95.5% |
| 321 | OP976237 | Pectobacterium carotovorum strain ZKo11 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 644.728 | 3.13e-180 | 95.5% |
| 322 | OP976238 | Pectobacterium carotovorum strain ZKo3 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 644.728 | 3.13e-180 | 95.5% |
| 323 | MK516922 | Pectobacterium wasabiae strain CFBP3304T DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 735.912 | 0.00e+00 | 95.4% |
| 324 | PP377830 | Pectobacterium carotovorum strain 21A25 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 454 | 96.8% | 733.929 | 0.00e+00 | 95.4% |
| 325 | MK516981 | Pectobacterium sp. GT-2019 strain RNS-08-43-2-2A DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 729.965 | 0.00e+00 | 95.4% |
| 326 | OR651842 | Pectobacterium actinidiae strain ECC5 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 729.965 | 0.00e+00 | 95.4% |
| 327 | MK516861 | Pectobacterium sp. GT-2019 strain A139-S21-M16 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 729.965 | 0.00e+00 | 95.4% |
| 328 | MK516932 | Pectobacterium sp. GT-2019 strain CFBP5548 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 729.965 | 0.00e+00 | 95.4% |
| 329 | MT684033 | Pectobacterium carotovorum strain CFBP7352 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 729.965 | 0.00e+00 | 95.4% |
| 330 | OR651847 | Pectobacterium actinidiae strain ECC33 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 729.965 | 0.00e+00 | 95.4% |
| 331 | MK516975 | Pectobacterium sp. GT-2019 strain CFBP8658 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 708.16 | 0.00e+00 | 95.4% |
| 332 | MW978970 | Pectobacterium versatile strain CIR1032 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 708.16 | 0.00e+00 | 95.4% |
| 333 | CP084656 | Pectobacterium versatile strain SR1 chromosome, complete genome | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 334 | MW839572 | Pectobacterium versatile strain Pv1620 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 335 | CP066552 | Pectobacterium carotovorum strain 2A chromosome, complete genome | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 336 | MW839571 | Pectobacterium versatile strain Pv1320 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 337 | CP034276 | Pectobacterium versatile strain 14A chromosome, complete genome | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 338 | PP377827 | Pectobacterium versatile strain 21A09 DNA polymerase I (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 339 | CP117874 | Pectobacterium carotovorum subsp. carotovorum strain ZJ-4-2 chromosome, complete genome | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 340 | CP045098 | Pectobacterium carotovorum strain ZM1 chromosome, complete genome | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 341 | ON960282 | Pectobacterium actinidiae strain PRI-B17 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 342 | MW805306 | Pectobacterium versatile strain Pv1520 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 343 | MW721611 | Pectobacterium carotovorum strain BL-4 DnaX (dnaX) gene, complete cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 344 | CP063380 | Pectobacterium versatile strain ECC15 chromosome, complete genome | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 345 | OP729211 | Pectobacterium carotovorum strain Pc2321 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 346 | ON960281 | Pectobacterium actinidiae strain PRI-B16 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 755.734 | 0.00e+00 | 95.3% |
| 347 | MK516968 | Pectobacterium actinidiae strain CFBP7370 DNA polymerase III subunit tau (dnaX) gene, partial cds | 449 | 95.7% | 724.018 | 0.00e+00 | 95.3% |
| 348 | OP376537 | Pectobacterium polaris strain L25F-105 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 727.983 | 0.00e+00 | 95.2% |
| 349 | MK516898 | Pectobacterium polaris strain CFBP1403 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 727.983 | 0.00e+00 | 95.2% |
| 350 | OP376539 | Pectobacterium polaris strain L25F-125 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 727.983 | 0.00e+00 | 95.2% |
| 351 | OP376536 | Pectobacterium polaris strain L25F-83 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 727.983 | 0.00e+00 | 95.2% |
| 352 | OP376538 | Pectobacterium polaris strain L25F-115 DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 727.983 | 0.00e+00 | 95.2% |
| 353 | MW979008 | Pectobacterium polaris strain CIR1140 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 700.231 | 0.00e+00 | 95.2% |
| 354 | MK516999 | Pectobacterium sp. GT-2019 strain RNS-752 DNA polymerase III subunit tau (dnaX) gene, partial cds | 419 | 89.3% | 672.479 | 0.00e+00 | 95.2% |
| 355 | OP976222 | Pectobacterium carotovorum strain CKh7 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 636.798 | 7.62e-178 | 95.2% |
| 356 | OP976221 | Pectobacterium carotovorum strain CKh22 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 636.798 | 7.62e-178 | 95.2% |
| 357 | OP976215 | Pectobacterium carotovorum strain CaKh45 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 636.798 | 7.62e-178 | 95.2% |
| 358 | OP976214 | Pectobacterium carotovorum strain CaKh33 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 397 | 84.6% | 636.798 | 7.62e-178 | 95.2% |
| 359 | CP024842 | Pectobacterium versatile strain 3-2 chromosome, complete genome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 360 | MT632647 | Pectobacterium carotovorum subsp. carotovorum strain JB63 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 361 | MT632645 | Pectobacterium carotovorum subsp. carotovorum strain JB55 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 362 | LC733512 | Pectobacterium versatile KNUB-02-21 dnaX gene for DNA polymerase III subunit tau, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 363 | CP017482 | Pectobacterium polaris strain NIBIO1392 chromosome, complete genome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 364 | PP869823 | Pectobacterium versatile strain IFB5701 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 365 | PP869826 | Pectobacterium versatile strain IFB5698 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 366 | MT632646 | Pectobacterium carotovorum subsp. carotovorum strain JB56 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 367 | CP065143 | Pectobacterium versatile strain DSM 30169 chromosome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 368 | MT632641 | Pectobacterium carotovorum subsp. carotovorum strain JB38 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 369 | CP015750 | Pectobacterium wasabiae CFBP 3304, complete genome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 370 | PP869824 | Pectobacterium versatile strain IFB5700 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 371 | CP021894 | Pectobacterium versatile strain SCC1 chromosome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 372 | MT632643 | Pectobacterium carotovorum subsp. carotovorum strain JB46 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 373 | MT632655 | Pectobacterium carotovorum subsp. carotovorum strain JB100 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 374 | PP869825 | Pectobacterium versatile strain IFB5699 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 375 | MW930747 | Pectobacterium versatile strain JB56A DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 376 | MT632652 | Pectobacterium carotovorum subsp. carotovorum strain JB95 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 377 | MT632653 | Pectobacterium carotovorum subsp. carotovorum strain JB96 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 378 | CP086369 | Pectobacterium versatile strain A73-S18-O15 chromosome, complete genome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 379 | CP084654 | Pectobacterium versatile strain SR12 chromosome, complete genome | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 380 | PP869827 | Pectobacterium versatile strain IFB5697 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 381 | OL963573 | Pectobacterium versatile strain LXRF-3 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 747.805 | 0.00e+00 | 95.1% |
| 382 | MK516873 | Pectobacterium sp. GT-2019 strain A80-S18-O15 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 722.036 | 0.00e+00 | 95.1% |
| 383 | OR521238 | Pectobacterium polaris strain BP7069 DnaX gene, partial cds | 430 | 91.7% | 686.355 | 0.00e+00 | 95.1% |
| 384 | LC798273 | Pectobacterium carotovorum P8 dnaX gene for DNA polymerase III subunit tau, partial cds | 437 | 93.2% | 692.302 | 0.00e+00 | 95.0% |
| 385 | MW978973 | Pectobacterium polaris strain CIR1047 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 692.302 | 0.00e+00 | 95.0% |
| 386 | PP869828 | Pectobacterium versatile strain IFB5696 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 387 | OR470476 | Pectobacterium polaris strain S5 polymerase III subunit tau (dnaX) gene, complete cds | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 388 | PP377892 | Pectobacterium parvum strain 21A28 DNA polymerase III subunit (dnaX) gene, partial cds | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 389 | OR470477 | Pectobacterium polaris strain S6 polymerase III subunit tau (dnaX) gene, complete cds | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 390 | CP087392 | Pectobacterium parvum strain FN20211 chromosome, complete genome | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 391 | PP869822 | Pectobacterium versatile strain IFB5702 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 392 | CP046377 | Pectobacterium parvum strain PZ1 chromosome, complete genome | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 393 | CP102749 | Pectobacterium parvum strain YT22221 chromosome, complete genome | 469 | 100.0% | 739.876 | 0.00e+00 | 94.9% |
| 394 | MT684046 | Pectobacterium polaris strain CFBP8603T DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 720.054 | 0.00e+00 | 94.9% |
| 395 | PP377894 | Pectobacterium polaris strain 21A78 DNA polymerase III subunit (dnaX) gene, partial cds | 466 | 99.4% | 733.929 | 0.00e+00 | 94.8% |
| 396 | OP976235 | Pectobacterium versatile strain PH62 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 397 | OP976213 | Pectobacterium versatile strain CaKh26 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 398 | OP976236 | Pectobacterium versatile strain PH75 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 399 | OP976217 | Pectobacterium versatile strain CaKh77 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 400 | OP976216 | Pectobacterium versatile strain CaKh54 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 401 | OP976234 | Pectobacterium versatile strain PH47 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 402 | OP976233 | Pectobacterium versatile strain PH35 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 403 | OP976218 | Pectobacterium versatile strain CaKh83 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 400 | 85.3% | 626.887 | 7.34e-175 | 94.8% |
| 404 | CP097896 | Pectobacterium actinidiae strain GX-Pa1 chromosome, complete genome | 469 | 100.0% | 731.947 | 0.00e+00 | 94.7% |
| 405 | CP017481 | Pectobacterium polaris strain NIBIO1006 chromosome, complete genome | 469 | 100.0% | 731.947 | 0.00e+00 | 94.7% |
| 406 | CP051628 | Pectobacterium versatile strain MYP201603 chromosome, complete genome | 469 | 100.0% | 729.965 | 0.00e+00 | 94.7% |
| 407 | MW979013 | Pectobacterium polaris strain CIR1152 DNA polymerase III subunit tau (dnaX) gene, partial cds | 437 | 93.2% | 684.373 | 0.00e+00 | 94.7% |
| 408 | LC798269 | Pectobacterium carotovorum P4 dnaX gene for DNA polymerase III subunit tau, partial cds | 437 | 93.2% | 684.373 | 0.00e+00 | 94.7% |
| 409 | KX819399 | Pectobacterium carotovorum subsp. carotovorum strain Sol4-4-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 426 | 90.8% | 662.568 | 0.00e+00 | 94.6% |
| 410 | MK516907 | Pectobacterium odoriferum strain CFBP1878T DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 698.249 | 0.00e+00 | 94.5% |
| 411 | MW657239 | Pectobacterium carotovorum strain IFB5369 DnaX (dnaX) gene, partial cds | 452 | 96.4% | 698.249 | 0.00e+00 | 94.5% |
| 412 | MT684038 | Pectobacterium polaris strain CFBP7360 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 696.266 | 0.00e+00 | 94.3% |
| 413 | KX819386 | Pectobacterium carotovorum subsp. carotovorum strain PK60-2-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 435 | 92.8% | 664.55 | 0.00e+00 | 94.3% |
| 414 | OR521239 | Pectobacterium polaris strain BP9026 DnaX gene, partial cds | 421 | 89.8% | 644.728 | 3.13e-180 | 94.3% |
| 415 | MT683953 | Pectobacterium odoriferum strain CFBP3260 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 690.32 | 0.00e+00 | 94.2% |
| 416 | MT684027 | Pectobacterium odoriferum strain CFBP6679 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 690.32 | 0.00e+00 | 94.2% |
| 417 | KX819363 | Pectobacterium carotovorum subsp. carotovorum strain na992-6-1-13 DNA polymerase III subunit tau (dnaX) gene, partial cds | 426 | 90.8% | 646.71 | 0.00e+00 | 94.1% |
| 418 | CP009678 | Pectobacterium carotovorum subsp. odoriferum strain BC S7, complete genome | 469 | 100.0% | 708.16 | 0.00e+00 | 94.0% |
| 419 | OP729217 | Pectobacterium odoriferum strain Po7521 DNA polymerase III subunit tau (dnaX) gene, partial cds | 469 | 100.0% | 708.16 | 0.00e+00 | 94.0% |
| 420 | PP734882 | Pectobacterium brasiliense strain 109009 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 682.391 | 0.00e+00 | 94.0% |
| 421 | CP034938 | Pectobacterium odoriferum strain JK2.1 chromosome, complete genome | 469 | 100.0% | 700.231 | 0.00e+00 | 93.8% |
| 422 | CP077421 | Pectobacterium polaris strain QK413-1 chromosome, complete genome | 469 | 100.0% | 676.444 | 0.00e+00 | 93.2% |
| 423 | MT683981 | Pectobacterium atrosepticum strain CFBP5394 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 656.621 | 0.00e+00 | 93.2% |
| 424 | MT683979 | Pectobacterium atrosepticum strain CFBP5391 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 656.621 | 0.00e+00 | 93.2% |
| 425 | OK416015 | Pectobacterium aroidearum strain Ea1 DnaX (dnaX) gene, partial cds | 452 | 96.4% | 650.674 | 0.00e+00 | 93.1% |
| 426 | MT684042 | Pectobacterium sp. strain CFBP797 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 650.674 | 0.00e+00 | 93.1% |
| 427 | BX950851 | Erwinia carotovora subsp. atroseptica SCRI1043, complete genome | 469 | 100.0% | 668.515 | 0.00e+00 | 93.0% |
| 428 | MK516935 | Pectobacterium peruviense strain CFBP5834 DNA polymerase III subunit tau (dnaX) gene, partial cds | 458 | 97.7% | 654.639 | 0.00e+00 | 93.0% |
| 429 | JN663801 | Pectobacterium carotovorum strain 3733 DNA polymerase III gamma subunit (dnaX) gene, partial cds | 446 | 95.1% | 638.781 | 1.93e-178 | 93.0% |
| 430 | OP018928 | Pectobacterium sp. strain ECC7 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 642.745 | 1.24e-179 | 92.9% |
| 431 | OR651868 | Pectobacterium aroidearum strain ZTC135 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 642.745 | 1.24e-179 | 92.9% |
| 432 | OR651853 | Pectobacterium aroidearum strain ECC32 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 642.745 | 1.24e-179 | 92.9% |
| 433 | OK416016 | Pectobacterium aroidearum strain Ea3 DnaX (dnaX) gene, partial cds | 452 | 96.4% | 642.745 | 1.24e-179 | 92.9% |
| 434 | MK516971 | Pectobacterium aroidearum strain CFBP8168T DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 642.745 | 1.24e-179 | 92.9% |
| 435 | PQ177849 | Pectobacterium peruviense strain M3 DNA polymerase III subunit gamma/tau gene, partial cds | 469 | 100.0% | 660.586 | 0.00e+00 | 92.8% |
| 436 | CP084023 | Pectobacterium aroidearum strain LJ2 chromosome, complete genome | 469 | 100.0% | 660.586 | 0.00e+00 | 92.8% |
| 437 | LC779905 | Pectobacterium aroidearum KNUB-08-21 dnaX gene for DNA polymerase III subunit gamma and tau, partial cds | 469 | 100.0% | 660.586 | 0.00e+00 | 92.8% |
| 438 | CP091064 | Pectobacterium sp. PL152 chromosome, complete genome | 469 | 100.0% | 660.586 | 0.00e+00 | 92.8% |
| 439 | MK516904 | Pectobacterium atrosepticum strain CFBP1526T DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 640.763 | 4.88e-179 | 92.7% |
| 440 | MT683921 | Pectobacterium zantedeschiae strain CFBP1357 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 455 | 97.0% | 640.763 | 4.88e-179 | 92.7% |
| 441 | MT892671 | Pectobacterium aroidearum strain Car1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 442 | OR651867 | Pectobacterium aroidearum strain ZLH253 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 443 | OR651852 | Pectobacterium aroidearum strain ECC21 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 444 | OR651866 | Pectobacterium aroidearum strain ZL11 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 445 | OR651865 | Pectobacterium aroidearum strain ZL10 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 446 | OR651859 | Pectobacterium aroidearum strain LTG1-1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 447 | OR651851 | Pectobacterium aroidearum strain ECC20 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 448 | OP018931 | Pectobacterium aroidearum strain OR13 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 449 | OR651862 | Pectobacterium aroidearum strain Zan5 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 450 | MT683927 | Pectobacterium aroidearum strain CFBP1492 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 451 | OR651856 | Pectobacterium aroidearum strain ECC48 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 452 | OR651864 | Pectobacterium aroidearum strain ZL1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 453 | OR651861 | Pectobacterium aroidearum strain Zan1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 454 | OR651863 | Pectobacterium aroidearum strain Zan9 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 634.816 | 3.01e-177 | 92.7% |
| 455 | CP118921 | Pectobacterium colocasium strain PL155 chromosome, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.6% |
| 456 | OR651857 | Pectobacterium aroidearum strain ECC55 DNA polymerase III subunit tau (dnaX) gene, partial cds | 462 | 98.5% | 646.71 | 0.00e+00 | 92.6% |
| 457 | MT683941 | Pectobacterium aroidearum strain CFBP2573 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 462 | 98.5% | 646.71 | 0.00e+00 | 92.6% |
| 458 | MT684048 | Pectobacterium peruviense strain CFBP8626 DNA polymerase III subunit gamma/tau (dnaX) gene, partial cds | 458 | 97.7% | 638.781 | 1.93e-178 | 92.6% |
| 459 | CP116477 | Pectobacterium sp. A5351 chromosome, complete genome | 469 | 100.0% | 694.7757 | 2.69e-195 | 92.6% |
| 460 | GQ904831 | Pectobacterium atrosepticum strain IPO 161 DNA polymerase III subunits gamma and tau (dnaX) gene, partial cds | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 461 | CP055224 | Pectobacterium atrosepticum strain Green1 chromosome, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 462 | CP036163 | Pectobacterium atrosepticum strain CFBP1526 chromosome, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 463 | MF787378 | Pectobacterium carotovorum subsp. carotovorum strain DOAC-B1596 DNA polymerase III subunits gamma and tau (dnaX) gene, partial cds | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 464 | CP009125 | Pectobacterium atrosepticum strain 21A, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 465 | MF954606 | Pectobacterium atrosepticum strain NY1589H DnaX (dnaX) gene, partial cds | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 466 | CP024956 | Pectobacterium atrosepticum strain 36A chromosome, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 467 | MT632648 | Pectobacterium atrosepticum strain JB87 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 468 | CP166097 | Pectobacterium aroidearum strain NCPPB 929 chromosome, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 469 | CP007744 | Pectobacterium atrosepticum strain JG10-08, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 470 | CP139172 | Pectobacterium zantedeschiae strain CFBP 1357 chromosome, complete genome | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 471 | MT632658 | Pectobacterium atrosepticum strain JB107 DnaX (dnaX) gene, partial cds | 469 | 100.0% | 652.657 | 0.00e+00 | 92.5% |
| 472 | OR651905 | Pectobacterium colocasium strain ECC53 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 473 | OR651854 | Pectobacterium aroidearum strain ECC34 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 474 | OR651907 | Pectobacterium colocasium strain ECC68 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 475 | OR651855 | Pectobacterium aroidearum strain ECC47 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 476 | OR651908 | Pectobacterium colocasium strain ECC69 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 477 | PP734873 | Pectobacterium aroidearum strain 10801 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 478 | OR651860 | Pectobacterium aroidearum strain XP1 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 479 | OR651904 | Pectobacterium colocasium strain ECC52 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 480 | OR651906 | Pectobacterium colocasium strain ECC56 DNA polymerase III subunit tau (dnaX) gene, partial cds | 452 | 96.4% | 626.887 | 7.34e-175 | 92.5% |
| 481 | CP063773 | Pectobacterium carotovorum subsp. carotovorum PCCS1 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 482 | CP161826 | Pectobacterium peruviense strain A350-S18-N16 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 483 | CP109769 | Pectobacterium aroidearum strain B2-6 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 484 | CP090588 | Pectobacterium aroidearum strain AK042 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 485 | CP104757 | Pectobacterium aroidearum strain QJ021 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 486 | CP090587 | Pectobacterium aroidearum strain AK049 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 487 | CP109770 | Pectobacterium aroidearum strain T25-1 chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 488 | AP028908 | Pectobacterium araliae MAFF 302110 DNA, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 489 | CP129239 | Pectobacterium aroidearum strain YKX chromosome, complete genome | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 490 | LC777352 | Pectobacterium aroidearum KNUB-05-21 dnaX gene for DNA polymerase III subunit gamma and tau, partial cds | 469 | 100.0% | 644.728 | 3.13e-180 | 92.3% |
| 491 | MK516878 | Pectobacterium fontis strain CFBP8629T DNA polymerase III subunit tau (dnaX) gene, partial cds | 455 | 97.0% | 624.905 | 2.90e-174 | 92.3% |
| 492 | CP032619 | Pectobacterium carotovorum strain HG-49 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 493 | CP090593 | Pectobacterium aroidearum strain QJ036 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 494 | CP169640 | Pectobacterium aroidearum strain Pc3 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 495 | CP090594 | Pectobacterium aroidearum strain QJ034 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 496 | CP090591 | Pectobacterium aroidearum strain QJ313 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 497 | CP065044 | Pectobacterium aroidearum strain L6 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 498 | CP090589 | Pectobacterium aroidearum strain QJ316 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 499 | CP001657 | Pectobacterium carotovorum subsp. carotovorum PC1, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
| 500 | CP090590 | Pectobacterium aroidearum strain QJ315 chromosome, complete genome | 469 | 100.0% | 636.798 | 7.62e-178 | 92.1% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |